MET Exon 14 Skipping Mutations in Lung Cancer

Properties
Location of mutation	Juxtamembrane domain (affecting exon 14)
Frequency of MET exon 14 skipping in lung adenocarcinoma	3–4% (Frampton et al. 2015; Onozato et al. 2009; Seo et al. 2012; TGCA 2014)
Implications for Targeted Therapeutics
Response to MET inhibitors	Confers increased sensitivity^a

MET alterations that result in exon 14 skipping are found in lung cancer in both the presence and absence of MET amplification (Awad et al. 2016; Frampton et al. 2015; Jenkins et al. 2015; Kollmannsberger et al. 2015; Liu et al. 2015; Onozato et al. 2009; Paik et al. 2015; Seo et al. 2012; TGCA 2014). Over 100 mutations in MET-mutated cancers resulting in exon 14 skipping have been described (Frampton et al. 2015). Exon 14 skipping results in the deletion of the juxtamembrane domain of MET, which leads to enhanced signaling through the MET receptor pathway (Kong-Beltran et al. 2006). This alteration is tumorigenic in xenograft models (Kong-Beltran et al. 2006).

^a Both preclinical and case report evidence suggest that tumors harboring MET with exon 14 alterations and/or MET amplifications have increased sensitivity to MET inhibitors.

Reference	Study Type	Diagnosis	Reported Alterations	Line of Metastatic Therapy	Therapy	Best Response	Duration of Response
Jenkins et al. 2015	Case report	Lung adenocarcinoma	MET c.2887-18_2887-7del12 exon 14 splicing variant CDKN2A/B-loss CDK4 amplification MDM2 amplification	Second	Crizotinib	Partial reponse	13 weeks (progression occured after therapy discontinuation
Paik et al. 2015	Case reports	Lung adenocarcinoma (poorly differentiated)	MET c. 3028G>C exon 14 splicing variant MET amplification RB1 intragenic deletion DICER1 Q1776* EPHA5 R853Q KLF4 M1I MLL I1929M MTOR D537N TERT G225E FUBP1 amplification GSK3B amplification SDHA amplification TERT amplification KDM5A amplification RAD52 amplification MDM2 amplification BCL2L1 amplification NKX3-1 deletion ETV6 deletion	Third	Cabozantinib	Stable disease	5.1 months (ongoing)
		Lung adenocarcinoma	MET c.3024_3028+7delAGAAGGTATATT exon 14 splicing variant TP53 exon 8 splice variant FAT1 R782fs FBXW7 G539V MLL E1678K NF1 E572fs NTKR2 I191T YES1 amplification	Third	Crizotinib	Partial reponse	3.6 months
		Lung adenocarcinoma	MET c.3001_3021delGTAGACTACCGAGCTACTTTT MET amplification TP53 R248P RB1 intragenic deletion BRCA1 E648Q MYC E137D NF1 exon 56 splice variant NDS1 E1902K PDGFRB R397W TERT gain MYC amplification NKX2-1 amplification	Third	Crizotinib	Partial reponse	4.6 months (ongoing)
		Lung adenocarcinoma	MET c.3028G>T exon 14 splicing variant CDK4 amplification MDM2 amplification	Third	Crizotinib	Partial reponse	3.1 months (ongoing)
Liu et al. 2015	Case report	Pulmonary sarcomatoid carcinoma	MET c.2888delA exon 14 splicing variant MET amplification	Third	Crizotinib	Partial reponse	NR
Lee et al. 2015	Case report	Sarcomatoid non-small cell lung carcinoma	MET c.2888-5_2890TTAAGATC>A exon 14 splicing variant MET c.3028+2T>G	Second	Crizotinib	Partial reponse	5 months
Frampton et al. 2015	Case reports	Large cell lung carcinoma	MET c.3028G>C exon 14 splicing variant MET amplification TP53 p.N30fs	First	Capmatinib	Partial reponse	5 months
Frampton et al. 2015	Case reports	Lung squamous cell carcinoma	MET c.3028+1G>T exon 14 splicing variant MET amplification	Third	Capmatinib	Partial reponse	13 months
Kollmannsberger et al. 2015	Case reports	Lung adenocarcinoma	MET c.2888-6_29del exon 14 splicing variant	Third	MGCD265	Partial reponse	5 cycles (ongoing)
Kollmannsberger et al. 2015	Case reports	Lung adenocarcinoma	MET c.3028+1G>T exon 14 splicing variant	First	MGCD265	Partial reponse	6 cycles (ongoing)
Schrock et al. 2016	Case reports	Lung adenocarcinoma	MET c.3028+1_3028+1delG exon 14 splicing variant MET amplification CDK4 amplification	NR	Crizotinib	Partial reponse	24 months
		Lung adenocarcinoma	MET D1010Y	NR	Crizotinib	Partial reponse	7 months (ongoing)
		Lung adenocarcinoma	MET c.3028+1delG exon 14 splicing variant MET amplification MDM2 amplification	NR	Crizotinib	Complete reponse	7 months (ongoing)
		Lung adenocarcinoma	MET D1010H	NR	Crizotinib	Stable Disease	4 months (ongoing)
		Lung adenocarcinoma	MET c.2888-16_2888-3del14 exon 14 splicing variant MET amplification MDM2 amplification	NR	Crizotinib	Partial reponse	10 months (ongoing)
		Lung squamous cell carcinoma	MET c.2888-11_2904del28 exon 14 splicing variant	NR	Crizotinib	Partial reponse	NR
		Lung adenocarcinoma	MET c.2888-16_2888-13delTTCT exon 14 splicing variant	NR	Crizotinib	Complete reponse	3 months (ongoing)
		Lung adenocarcinoma	MET c.3028+1G>A exon 14 splicing variant	NR	Crizotinib	Complete reponse	Unresectable to resectable and NED after resection
Awad et al. 2016	Case report	Lung adenocarcinoma (poorly differentiated)	MET c.3028G>A exon 14 splicing variant MET amplification	Second	Crizotinib	Partial reponse	8 months (ongoing)

Notes: NR = Not reported; NED = No evidence of disease

Contributors: Christine M. Lovly, M.D., Ph.D., Paul K. Paik, M.D.

Suggested Citation: Lovly, C., P. Paik. 2017. MET Exon 14 Skipping Mutations in Lung Cancer. My Cancer Genome https://www.mycancergenome.org/content/disease/lung-cancer/met/343/ (Updated June 15).

Last Updated: June 15, 2017

My Cancer Genome has released its new and improved cancer clinical trials search tool on our beta website. Please visit beta.mycancergenome.org to check it out!

Disclaimer: The information presented at MyCancerGenome.org is compiled from sources believed to be reliable. Extensive efforts have been made to make this information as accurate and as up-to-date as possible. However, the accuracy and completeness of this information cannot be guaranteed. Despite our best efforts, this information may contain typographical errors and omissions. The contents are to be used only as a guide, and health care providers should employ sound clinical judgment in interpreting this information for individual patient care.

MET

Related Pathways

MET in Non-Small Cell Lung Cancer (NSCLC)

MET Exon 14 Skipping Mutations in Lung Cancer